Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1972862
End position: 1972885
Length: 24

DNA sequence
>NC_007651, from 1972862 to 1972885 (24 bp); Burkholderia thailandensis E264 GCGCGGGGGCGGGAGCGGGCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1971539-1972942	Sequence	BTH_I1761 - amino acid ABC transporter periplasmic amino acid-binding protein (Protein is coded in complementary strand; from 1972942 to 1971539)