Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2158338
End position: 2158361
Length: 24

DNA sequence
>NC_007651, from 2158338 to 2158361 (24 bp); Burkholderia thailandensis E264 CGACGAAGACGAGGACGACGACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2157851-2158396	Sequence	BTH_I1911 - FKBP-type peptidyl-prolyl cis-trans isomerase 2