Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2367845
End position: 2367868
Length: 24

DNA sequence
>NC_007651, from 2367845 to 2367868 (24 bp); Burkholderia thailandensis E264 GCGGTGCGGCGCTGCGGCGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2367630-2368340	Sequence	BTH_I2089 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase