Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2379832
End position: 2379855
Length: 24

DNA sequence
>NC_007651, from 2379832 to 2379855 (24 bp); Burkholderia thailandensis E264 CCGCGGCCGCCGCTGCGGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2379753-2380178	Sequence	BTH_I2104 - PAAR motif-containing protein (Protein is coded in complementary strand; from 2380178 to 2379753)