Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2541108
End position: 2541131
Length: 24

DNA sequence
>NC_007651, from 2541108 to 2541131 (24 bp); Burkholderia thailandensis E264 GTGCAGATGCAGGAGCAGATGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2540506-2541210	Sequence	BTH_I2258 - polyhydroxyalkanoate synthesis repressor PhaR