Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2631908
End position: 2631931
Length: 24

DNA sequence
>NC_007651, from 2631908 to 2631931 (24 bp); Burkholderia thailandensis E264 TGCGCGTGAGCGTGCGCGTGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2631421-2632614	Sequence	BTH_I2337 xylR xylose operon regluatory protein (Protein is coded in complementary strand; from 2632614 to 2631421)