Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2836080
End position: 2836103
Length: 24

DNA sequence
>NC_007651, from 2836080 to 2836103 (24 bp); Burkholderia thailandensis E264 GCGAGCGCGCGCGCGAGCGCGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2835480-2836535	Sequence	BTH_I2477 - sulfate ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 2836535 to 2835480)