Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2837827
End position: 2837850
Length: 24

DNA sequence
>NC_007651, from 2837827 to 2837850 (24 bp); Burkholderia thailandensis E264 CGAGCGCGCGCGCGAACGCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2837568-2838488	Sequence	BTH_I2479 cysT sulfate ABC transporter permease CysT (Protein is coded in complementary strand; from 2838488 to 2837568)