Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2894659
End position: 2894682
Length: 24

DNA sequence
>NC_007651, from 2894659 to 2894682 (24 bp); Burkholderia thailandensis E264 CGCGCCCACGCCCGCGCCCGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2894531-2895418	Sequence	BTH_I2537 - TPR domain-containing protein (Protein is coded in complementary strand; from 2895418 to 2894531)