Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2959821
End position: 2959844
Length: 24

DNA sequence
>NC_007651, from 2959821 to 2959844 (24 bp); Burkholderia thailandensis E264 CTCCGGCTCGGGCTCGGGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2959309-2961486	Sequence	BTH_I2597 - GTP pyrophosphokinase (Protein is coded in complementary strand; from 2961486 to 2959309)