Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2989973
End position: 2989996
Length: 24

DNA sequence
>NC_007651, from 2989973 to 2989996 (24 bp); Burkholderia thailandensis E264 GTCGCGGCCGCGCTCGCGGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2989362-2991563	Sequence	BTH_I2626 - fusaric acid resistance domain-containing protein