Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3023681
End position: 3023704
Length: 24

DNA sequence
>NC_007651, from 3023681 to 3023704 (24 bp); Burkholderia thailandensis E264 ACGATGACGATGGCGATGACGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3022861-3025086	Sequence	BTH_I2652 - branched-chain amino acid ABC transporter permease/ATP binding protein (Protein is coded in complementary strand; from 3025086 to 3022861)