Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3253100
End position: 3253123
Length: 24

DNA sequence
>NC_007651, from 3253100 to 3253123 (24 bp); Burkholderia thailandensis E264 GCTGATCGACTGATCGACTGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3252289-3253113	Sequence	BTH_I2835 - Ser/Thr protein phosphatase family protein