Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3273242
End position: 3273265
Length: 24

DNA sequence
>NC_007651, from 3273242 to 3273265 (24 bp); Burkholderia thailandensis E264 GCGCGCGCACGCGCGAGCCCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3270919-3274884	Sequence	BTH_I2851 recB exodeoxyribonuclease V subunit beta (Protein is coded in complementary strand; from 3274884 to 3270919)