Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3285980
End position: 3286003
Length: 24

DNA sequence
>NC_007651, from 3285980 to 3286003 (24 bp); Burkholderia thailandensis E264 TCGCGCTCGCCCGCGCGCTCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3285533-3286312	Sequence	BTH_I2858 - iron compound ABC transporter ATP-binding protein