Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3316838
End position: 3316861
Length: 24

DNA sequence
>NC_007651, from 3316838 to 3316861 (24 bp); Burkholderia thailandensis E264 GACGCCGACGCCGACGCCGACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3314755-3316977	Sequence	BTH_I2882 - two-component hybrid sensor and regulator (Protein is coded in complementary strand; from 3316977 to 3314755)