Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3468723
End position: 3468746
Length: 24

DNA sequence
>NC_007651, from 3468723 to 3468746 (24 bp); Burkholderia thailandensis E264 GGCATTGGCGTTGGCGTTGGCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3467494-3469224	Sequence	BTH_I3025 - type II/III secretion system protein (Protein is coded in complementary strand; from 3469224 to 3467494)