Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 355255
End position: 355278
Length: 24

DNA sequence
>NC_007651, from 355255 to 355278 (24 bp); Burkholderia thailandensis E264 GCCAAGCCGTCAAGCCGCCGAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 354946-355305	Sequence	BTH_I0324 - sensor histidine kinase (Protein is coded in complementary strand; from 355305 to 354946)