Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3618575
End position: 3618598
Length: 24

DNA sequence
>NC_007651, from 3618575 to 3618598 (24 bp); Burkholderia thailandensis E264 GCGGCAGCGACAGCGGCCGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3617572-3619038	Sequence	BTH_I3171 - phytoene dehydrogenase (Protein is coded in complementary strand; from 3619038 to 3617572)