Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3621030
End position: 3621053
Length: 24

DNA sequence
>NC_007651, from 3621030 to 3621053 (24 bp); Burkholderia thailandensis E264 GCCGCCGTCGCCGCCGCCGCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3619819-3621132	Sequence	BTH_I3173 - lipoprotein (Protein is coded in complementary strand; from 3621132 to 3619819)