Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3718495
End position: 3718518
Length: 24

DNA sequence
>NC_007651, from 3718495 to 3718518 (24 bp); Burkholderia thailandensis E264 GGGCGCGGGGGCGAGCGCGTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3717747-3718523	Sequence	BTH_I3258 - GDSL-like lipase/acylhydrolase domain-containing protein (Protein is coded in complementary strand; from 3718523 to 3717747)