Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 374071
End position: 374094
Length: 24

DNA sequence
>NC_007651, from 374071 to 374094 (24 bp); Burkholderia thailandensis E264 CCGCCTCCGCCAGCGCCTTCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 373545-374564	Sequence	BTH_I0337 bioB biotin synthase (Protein is coded in complementary strand; from 374564 to 373545)