Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3745622
End position: 3745645
Length: 24

DNA sequence
>NC_007651, from 3745622 to 3745645 (24 bp); Burkholderia thailandensis E264 CGGCCGCGGCCGCCGCCGCGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3744829-3747321	Sequence	BTH_I3290 - cadmium-translocating P-type ATPase (Protein is coded in complementary strand; from 3747321 to 3744829)