Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3756462
End position: 3756485
Length: 24

DNA sequence
>NC_007651, from 3756462 to 3756485 (24 bp); Burkholderia thailandensis E264 ACCGCGAACGCGCCCGCGACCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3755802-3756941	Sequence	BTH_I3300 - amino acid ABC transporter periplasmic amino acid-binding protein (Protein is coded in complementary strand; from 3756941 to 3755802)