Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 380143
End position: 380166
Length: 24

DNA sequence
>NC_007651, from 380143 to 380166 (24 bp); Burkholderia thailandensis E264 GCGCGCGCGCGTTCGCGCTCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 379779-380231	Sequence	BTH_I0342 - hypothetical protein (Protein is coded in complementary strand; from 380231 to 379779)