Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 402529
End position: 402552
Length: 24

DNA sequence
>NC_007651, from 402529 to 402552 (24 bp); Burkholderia thailandensis E264 AGCGCGAGCACGAGCGCGAGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 401290-402621	Sequence	BTH_I0360 - hypothetical protein (Protein is coded in complementary strand; from 402621 to 401290)