Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 669644
End position: 669667
Length: 24

DNA sequence
>NC_007651, from 669644 to 669667 (24 bp); Burkholderia thailandensis E264 CACGCGCTCGCGAACGCGAACGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 668405-670120	Sequence	BTH_I0586 lnt apolipoprotein N-acyltransferase (Protein is coded in complementary strand; from 670120 to 668405)