Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 824656
End position: 824679
Length: 24

DNA sequence
>NC_007651, from 824656 to 824679 (24 bp); Burkholderia thailandensis E264 CGCCGGCGCGGGCGCCGGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 823548-825065	Sequence	BTH_I0715 - hypothetical protein (Protein is coded in complementary strand; from 825065 to 823548)