Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 871613
End position: 871636
Length: 24

DNA sequence
>NC_007651, from 871613 to 871636 (24 bp); Burkholderia thailandensis E264 GCGAGCGCGAGCGCGACCGCGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 871178-871693	Sequence	BTH_I0757 - hypothetical protein (Protein is coded in complementary strand; from 871693 to 871178)