Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 96918
End position: 96941
Length: 24

DNA sequence
>NC_007651, from 96918 to 96941 (24 bp); Burkholderia thailandensis E264 CGGGCGCGGACGCCGGCGCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 96449-97024	Sequence	BTH_I0090 - hypothetical protein (Protein is coded in complementary strand; from 97024 to 96449)