Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1135398
End position: 1135422
Length: 25

DNA sequence
>NC_007651, from 1135398 to 1135422 (25 bp); Burkholderia thailandensis E264 CGAGCCGAGCCGAGGCGATCCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1134765-1135616	Sequence	BTH_I0996 - carboxymuconolactone decarboxylase family protein (Protein is coded in complementary strand; from 1135616 to 1134765)