Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1531543
End position: 1531567
Length: 25

DNA sequence
>NC_007651, from 1531543 to 1531567 (25 bp); Burkholderia thailandensis E264 CGCGTCGCGGCTCGTCGTGTCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1531254-1533494	Sequence	BTH_I1354 - exopolysaccharide tyrosine-protein kinase