Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2042493
End position: 2042517
Length: 25

DNA sequence
>NC_007651, from 2042493 to 2042517 (25 bp); Burkholderia thailandensis E264 CGCGCTGCGCAGCGCCGCGACGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2042135-2043064	Sequence	BTH_I1819 - phosphopantetheinyltransferase family protein