Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2238679
End position: 2238703
Length: 25

DNA sequence
>NC_007651, from 2238679 to 2238703 (25 bp); Burkholderia thailandensis E264 CGCGCAGCGCCTCGCCGTGCTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2238432-2240741	Sequence	BTH_I1975 - molybdopterin oxidoreductase family protein