Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2686914
End position: 2686938
Length: 25

DNA sequence
>NC_007651, from 2686914 to 2686938 (25 bp); Burkholderia thailandensis E264 GCGACGCGTCGCGCCGCGCCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2686625-2691724	Sequence	BTH_I2367 - dihydroaeruginoic acid synthetase (Protein is coded in complementary strand; from 2691724 to 2686625)