Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2858650
End position: 2858674
Length: 25

DNA sequence
>NC_007651, from 2858650 to 2858674 (25 bp); Burkholderia thailandensis E264 GCGCGACGCGGCGCTGCGCCGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2858637-2858861	Sequence	BTH_I2503 - hypothetical protein (Protein is coded in complementary strand; from 2858861 to 2858637)