Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3350468
End position: 3350492
Length: 25

DNA sequence
>NC_007651, from 3350468 to 3350492 (25 bp); Burkholderia thailandensis E264 TCTGCTCGGCGCTGCGCTGCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3350083-3350679	Sequence	BTH_I2915 - acyl carrier protein phosphodiesterase (Protein is coded in complementary strand; from 3350679 to 3350083)