Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1181152
End position: 1181178
Length: 27

DNA sequence
>NC_007651, from 1181152 to 1181178 (27 bp); Burkholderia thailandensis E264 GCGGCTCGTGCGGCTCGGGGGGCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1180734-1181279	Sequence	BTH_I1038 - diacylglycerol kinase (Protein is coded in complementary strand; from 1181279 to 1180734)