Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1891033
End position: 1891059
Length: 27

DNA sequence
>NC_007651, from 1891033 to 1891059 (27 bp); Burkholderia thailandensis E264 GCGGCACGCCCGGCACGCCCGGCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1890348-1893095	Sequence	BTH_I1681 - RE17165p (Protein is coded in complementary strand; from 1893095 to 1890348)