Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1896280
End position: 1896306
Length: 27

DNA sequence
>NC_007651, from 1896280 to 1896306 (27 bp); Burkholderia thailandensis E264 CGCGCGCAGCGTGCGCAGCGCGGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1895396-1896790	Sequence	BTH_I1685 fumC fumarate hydratase (Protein is coded in complementary strand; from 1896790 to 1895396)