Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2259152
End position: 2259178
Length: 27

DNA sequence
>NC_007651, from 2259152 to 2259178 (27 bp); Burkholderia thailandensis E264 GCGCCCGCAGCGCGCGCAGCGCCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2258752-2259507	Sequence	BTH_I1995 dehII-1 haloacid dehalogenase, type II (Protein is coded in complementary strand; from 2259507 to 2258752)