Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2263528
End position: 2263554
Length: 27

DNA sequence
>NC_007651, from 2263528 to 2263554 (27 bp); Burkholderia thailandensis E264 GCCCGAGCGGCCCGCGCGGCCCGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2263208-2264656	Sequence	BTH_I1999 - ATP-dependent RNA helicase RhlE (Protein is coded in complementary strand; from 2264656 to 2263208)