Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2390885
End position: 2390911
Length: 27

DNA sequence
>NC_007651, from 2390885 to 2390911 (27 bp); Burkholderia thailandensis E264 CGAGCGGGCCGCGCGGGCCGAGGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2389695-2391251	Sequence	BTH_I2117 - glycerate kinase 1 (Protein is coded in complementary strand; from 2391251 to 2389695)