Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2476263
End position: 2476289
Length: 27

DNA sequence
>NC_007651, from 2476263 to 2476289 (27 bp); Burkholderia thailandensis E264 CGTCGCGCTCGTCGCGCTCGTCGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2476026-2477708	Sequence	BTH_I2200 - molybdopterin biosynthesis moeA protein