Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2542617
End position: 2542643
Length: 27

DNA sequence
>NC_007651, from 2542617 to 2542643 (27 bp); Burkholderia thailandensis E264 TCGGCGCGCTCGGCGAGCTCGCCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2541918-2543309	Sequence	BTH_I2259 rimO ribosomal protein S12 methylthiotransferase