Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2727942
End position: 2727968
Length: 27

DNA sequence
>NC_007651, from 2727942 to 2727968 (27 bp); Burkholderia thailandensis E264 CGCGCTCGCGGCGCTCGCGGCGCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2726984-2728423	Sequence	BTH_I2398 - nitrite/sulfite reductase domain-containing protein