Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2766177
End position: 2766203
Length: 27

DNA sequence
>NC_007651, from 2766177 to 2766203 (27 bp); Burkholderia thailandensis E264 CCGCGTTGCCAGCGTTGCCCACGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2758217-2768107	Sequence	BTH_I2418 - peptide synthetase-like protein (Protein is coded in complementary strand; from 2768107 to 2758217)