Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 2831171
End position: 2831197
Length: 27

DNA sequence
>NC_007651, from 2831171 to 2831197 (27 bp); Burkholderia thailandensis E264 AGCGCGATCAGCGCGATCAGCGCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2830298-2831311	Sequence	BTH_I2473 rbsC ribose ABC transporter permease (Protein is coded in complementary strand; from 2831311 to 2830298)