Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3035514
End position: 3035540
Length: 27

DNA sequence
>NC_007651, from 3035514 to 3035540 (27 bp); Burkholderia thailandensis E264 TGCGCGCGGTGCGCGCGCGGCGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3034577-3037201	Sequence	BTH_I2661 alaS alanyl-tRNA synthetase (Protein is coded in complementary strand; from 3037201 to 3034577)