Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 3054683
End position: 3054709
Length: 27

DNA sequence
>NC_007651, from 3054683 to 3054709 (27 bp); Burkholderia thailandensis E264 GCGTCGCGCGCGTCGAGCGCGGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3053876-3055831	Sequence	BTH_I2675 - sensor histidine kinase/response regulator (Protein is coded in complementary strand; from 3055831 to 3053876)